Alternative PremRNA Processing of Exon Vb

Exon V of the 5-HT2C pre-mRNA has three alternative 5' splice sites, proximal P, distal D, and intronic I. Different authors use different nomenclatures for these sites, for example, splice site I, II, and III. Their location is shown in Fig. 21.1a. The usage of these sites define exon Vb and Vc (Fig. 21.1a). There is RT-PCR evidence for the usage of the intronic site I (also named donor site III), but a full-length mRNA containing exon Vc has not been described. However, the RT-PCR data suggest that RNAs with this exon exist (Flomen et al. 2004). Alternative usage of exon Vb is documented in mRNA databases. Exon Vb is of special importance for the regulation of the 5-HT2C pre-mRNA, since it is located in the coding region of the protein and is targeted by both RNA editing and alternative splicing. Exon Vb encodes the part of the protein that composes its second intracellular loop. This loop couples to the G protein and is therefore essential for signaling. The exon is 95 nucleotides long and, thus, can not accommodate an integer number of the three-nucleotide long codons. Therefore, skipping of this exon causes a frameshift and leads to the generation of a truncated receptor mRNA. It is not clear whether this mRNA is translated into a nonfunctional receptor that lacks the G-protein-coupling ability or undergoes nonsense-mediated RNA decay. Nonsense mediated decay is a posttranscrip-tional surveillance mechanism that can degrade mRNA with premature stop codons (Neu-Yilik and Kulozik 2008). Since there is no published evidence for the expression of short 5-HT2C mRNA forms, it is likely that skipping of exon Vb leads to the degradation of the resulting mRNA. Exon Vb is localized in a predicted extended secondary structure that harbors editing sites described above (Fig. 21.2). In addition to the five edited adenine residues in exon Vb, a sixth site in exon Vc has been described (Flomen et al. 2004). Editing of these nucleotides changes the encoded protein in the second intracellular loop that is involved in receptor signaling.

In addition to influencing the encoded protein, editing influences the splicing of exon Vb when tested in cell culture based assays (Flomen et al. 2004; Kishore and Stamm 2006a). The distal splice site (TAGgtaaat) deviates on two positions from the consensus, "optimal" 5' splice site (AAGgtaagt). The splice site is not used when analyzed in reporter gene assays. In these types of assays, a fragment of the gene is transfected into cells and the splicing pattern is analyzed by subsequent RT-PCR (reviewed in Tang et al. 2005; Stoss et al. 1999). These analyses showed that when the splice site is mutated into the consensus sequence, the exon is included into the mRNA (Kishore and Stamm 2006a). However, even after this splice site is mutated into a perfect mammalian consensus, exon Vb is still predominantly skipped. This suggested the existence of a splicing silencer element in the exon. Such a silencing element was bioinfor-matically predicted in the exon (Kishore and Stamm 2006a). This splicing silencing element partially overlaps with the adenine editing sites. Their conversion from adenine to inosine in the editing process weakens the splicing silencer, and as a result, exon Vb is now included (Flomen et al. 2004; Kishore and Stamm 2006a). These experiments were performed in transfected cell lines that have a different set of splicing regulatory proteins than differentiated neurons that express the 5-HT2C receptor under physiological conditions. When the effect of editing of exon Vb was studied in knock-in mouse models no effect on

Proximal Splice site

Exon Va r^-Exon Vb

gaucg|g3 UGU UgIguca aca

Sno CR

GCA UACGUAAuCC auugagcauagccguu caauuc ua GGCCAuC UGU auguauuagg uaacucguaucggcga guuaag au ccggu uu

Intron V

CA uC uu

Splicing donor site III

U Distal Splice site

AA AA

AUGAGAA CCUUAUAUUGUCCUGAAGAGA

HBII-52

<2 Gd Antisense Box

C GCAUUAGGAUAACUCGUA CUAAAAAUU

CGUAAUCCUAUUGAGCAU

AGCCGUU 3'

UGGGUC

Fig. 21.2 Predicted RNA structure of exon Vb and complementarity to the snoRNA HBII-52. (a) RNA structure: The sequence of the serotonin receptor 5-HT2C exon V is indicated. Arrows point to the five nucleotides that are edited from A to I (A-E editing sites). Structural elements are indicated by shading: UDS upstream distal splice site, DDS downstream distal splice site, sno-CR snoRNA complementarity region. The base at editing site C fulfills the requirements to be 2'-0-methylated (circle) by the snoRNA. Exon Vb is indicated by arrows; the GU nucleotides of the proximal, distal, and donor site III are boxed. (b) Complementarity between exon Vb and the snoRNA HBII-52. The snoRNA is shown in 3'-5' orientation to illustrate the base pairing with the sno-CR of the serotonin receptor. The structural elements of the snoRNA, the C, C' box, D, D' box, and antisense box are indicated exon inclusion was found. In these mice, the wild-type exon Vb was substituted with an exon that had adenine-to-guanine mutations at the five editing sites (Kawahara et al. 2008). This suggests the presence of an activity in neurons that promotes exon Vb inclusion and can overwrite the influence of a splicing silencer.

Exon Vb harbors an 18 nt sequence that exhibits full complementarity to the antisense box of a small nucleolar RNA (snoRNA), HBII-52. The official name of this snoRNA is SNORD115, but the historical name HBII-52 for "second human brain library, clone number 52," is widely used in the literature. The snoRNA HBII-52 is expressed only in neurons (Cavaille et al. 2000), and its coexpression with 5 HT2C splicing reporter constructs promotes exon Vb inclusion in cell culture based assays (Kishore and Stamm 2006a). This finding suggested that the snoRNA HBII-52 is involved in splice site selection of the 5-HT2C receptor pre-mRNA.

Defeat Drugs and Live Free

Defeat Drugs and Live Free

Being addicted to drugs is a complicated matter condition that's been specified as a disorder that evidences in the obsessional thinking about and utilization of drugs. It's a matter that might continue to get worse and become disastrous and deadly if left untreated.

Get My Free Ebook


Post a comment