[31 Transgenic Model for the Study of Oxidative Damage in Huntingtons Disease

By José Segovia

Introduction

Huntington's disease (HD) is a hereditary neurodegenerative disorder characterized by motor, psychiatric, and cognitive symptoms. To reproduce some of the biochemical, morphological, and behavioral alterations of HD several acute animal models have been developed. Intrastriatal injection of glutamate analogs, such as kainic acid,1 ibotenic acid,2 and quinolic acid,3 or of a mitochondrial inhibitor, 3-nitropropionic acid,4 forms the basis of some of the best studied models used in rodents.

More recently, however, a new system for modeling HD has emerged. The disease is caused by an abnormal expansion of the CAG repeats that encode a polyglutamine tract in a novel protein called huntingtin (htt).5 Because the genetic defect responsible for the onset of the disease has been unambiguously identified, the concept of generating animal models of the human disease by manipulating

1 J. T. Coyle and R. Schwarcz, Nature (London) 263, 244 (1976).

2 R. Schwarcz, T. Hokfelt, K. Fuxe, G. Jonsson, M. Goldstein, and L. Terenius, Exp. Brain Res. 37, 199(1979).

3 M. F. Beal, N. W. Kowall, D. W. Ellison, M. F. Mazurek, R. Schwarcz, and J. B. Martin, Nature (London) 321, 168 (1986).

4 E. Brouillet, B. G. Jenkins, B. T. Hyman, R. J. Ferrante, N. W. Kowall, R. Srivastava, D. S. Roy, B. R. Rosen, and M. F. Beal, J. Neurochem. 60, 356 (1993).

5 Huntington's Disease Collaborative Research Group, Cell 72,971 (1993).

the expression of the affected gene has been widely used. Early embryonic death of knockout mice for the murine homolog of htt has demonstrated the fundamental role of the protein during development.6-8 However, the function of the protein in the CNS could not be determined from these experiments. On the other hand, precise knowledge of the genetic defect present in HD has also allowed the generation of transgenic animals, particularly mice, that express the HD mutation. Several of the transgenic mouse lines present biochemical and morphological alterations in the striatum, and display progressive neurological phenotypes.9'12 The mechanism(s) by which the expanded polyglutamine tract causes cell death, particularly of the medium spiny y-aminobutyric acid (GABA)-containing neurons in the caudate putamen of patients, remains unclear. However, it has been proposed that defects in the energy metabolism of the affected cells, which may cause the formation of free radicals, are important components in the etiology of the disease.13'14

Oxidative damage is one of the major consequences of defects in energy metabolism, and it is present in HD models induced by the injection of excito-toxins and mitochondrial inhibitors.15 Moreover, we have observed a correlation between the onset of the neurological phenotype and striatal free radical-induced damage in one line of transgenic mice, R6/1,16 expressing a human mutated htt exon 1 with 116 CAG repeats.9 Other studies have shown that mice transgenic for the HD mutation present mitochondrial defects and increased NO production.1718 All these results suggest that mice transgenic for HD are an important tool for the study of the cellular mechanisms underlying the onset of HD, and particularly

6 M. P. Duyao, A. B. Auerbach, A. Ryan, F. Persichetti, G. T. Barnes, S. M. McNeil, P. Ge, J.-P. Vonsattel, J. F. Gusella, A. L. Joyner, and M. E. MacDonald, Science 269, 407 (1995).

7 J. Nasir, S. B. Floresco, J. R. O'Kuskey, V. M. Diewert, J. M. Richman, J. Zeisler, A. Borowski, J. D. Marth, A. G. Philips, and M. R. Hayden, Cell 81, 811 (1995).

8 S. Zeitlin, J.-P. Liu, V. E. Papaionnou, and A. Efstradiatis, Nat. Genet. 11, 155 (1995).

9L. Mangiarini, K. Sathasivam, M. Seller, B. Cozens, A. Harper, C. Hetherington, M. Lawton, Y. Trottier, H. Lehrach, S. W. Davies, and G. P. Bates, Cell 87,493 (1996).

10 P. H. Reddy, M. Williams, V. Charles, L. Garrett, L. Pike-Buchanan, W. O. Whetsell, G. Miller, and D. A. Tagle, Nat. Genet. 20, 198 (1998).

11 J. G. Hodgson, N. Agopyan, C. A. Gutekunst, B. R. Leavitt, F. LePiane, R. Singaraja, D. J. Smith, N. Bissada, K. McCutcheon, J. Nasir, L. Jamot, X. J. Li, M. E. Stevens, E. Rosemond, J. C. Roder, A. G. Philips, E. M. Rubin, S. M. Hersch, and M. R. Hayden, Neuron 23, 181 (1999).

12 A. Yamamoto, J. J. Lucas, and R. Hen, Cell 101, 57 (2000).

13 M. F. Beal, Biochim. Biophys. Acta 1366, 211 (1998).

14 A. H. V. Schapira, Biochim. Biophys. Acta 1410, 159 (1999).

15 A. Petersén, K. Mani, and P. Brundin, Exp. Neurol. 157, 1 (1999).

16 F. Pérez-Severiano, C. Ríos, and J. Segovia, Brain Res. 862, 234 (2000).

17 S. J. Tabrizi, J. Workman, P. E. Hart, L. Mangiarini, A. Mahal, G. Bates, J. M. Cooper, and A. H. V. Schapira, Ann. Neurol. 47, 80 (2000).

18 M. Chen, V. O. Ona, M. Li, R. J. Ferrante, K. B. Fink, S. Zhu, J. Bian, L. Guo, S. M. Hersch, W. Hobbs, J.-P. Vonsattel, J.-H. J. Cho, and R. M. Friedlander, Nat. Med. 6, 797 (2000).

in the evaluation of the participation of oxidative damage. This chapter discusses some techniques we have used to determine the oxidative status of striata of mice transgenic for HD.

Experimental Procedure Animal Handling and Genotype

We employ R6/1 males of the CBA x C57BL/6 strain, which carry a human mutated exon 1 with approximately 116 CAG repeats.9 R6/1 male mice and nontransgenic CBA female mice are purchased from Jackson Laboratory (Bar Harbor, ME), and a colony has been established in our vivarium. The macro-environmental conditions of the room are maintained by a heating, ventilation, and air-conditioning (HVAC) system controlled by Excell 5000 system software (Honeywell). Relative humidity is kept at 50 ± 10%, and 10-15 changes of air volume are performed per hour. The HVAC system is equipped with 35% efficiency prefilters, and 95% efficiency HEPA filters. Mice are housed in cages isolated with a microbarrier system with electrostatic filter (MBS 7105 and MBS 10196; Allentown Caging Equipment, Allentown, NJ); this equipment is autoclavable. Mice are kept under controlled temperatures (20 ±2°) with a regulated 12-hr light-dark cycle and with ad libitum access to food and water. Food pellets (lab rodent breeder diet 5013; Purina Mills, St. Louis, MO) and bedding (shredded aspen; Northeastern Products, Warrensburg, NY) are autoclaved, and water is ozone purified and autoclaved. Mice are changed twice a week and are under permanent veterinary observation. All handling of animals is performed under a hood.19 All animal procedures have been approved by the Institutional Review Committee, and are in accordance with the National Institutes of Health (NIH, Bethesda, MD) Guide for the Care and Use of Laboratory Animals.

Transgenic R6/1 mice are hemizygous for the HD mutation, and carry a single copy of the transgene. Male R6/1 transgenic mice are crossed to noncarrying CBA females and the genotype is determined by using the polymerase chain reaction (PCR). Transgenic mice, and nontransgenic littermates, are identified and used for the following experiments. All mice that develop the neurological phenotype have been genotyped as transgenics. To obtain DNA, samples from ear tissue are obtained from mice 4 to 5 weeks old. Each sample is approximately 3 mm in diameter, and is added to 20 ¡Ú of lysis buffer. The buffer consists of 50 mM Tris-HCl-20 mM NaCl-0.3% (w/v) sodium dodecyl sulfate (SDS), and 2 /il of proteinase K is added (from a 10-mg/ml stock solution) to obtain a 22-/xl volume. Samples are incubated at 55° for 15 min, and then vigorously shaken and cen-trifuged at 7780g for 30 sec. This last procedure is repeated twice. Distilled sterile

19 J. H. Fernández, J. Segovia, M. Flores, Y. Heuze, and F. Pérez, Anim. Exp. 5, 17 (2000).

water (28 /xl) is added to obtain a 50-/xl final volume. Samples are finally boiled for 7 min, cooled, and stored at —20° until PCR assays are performed.20 Isolated DNA is checked by running samples in a 1 % agarose gel and staining with ethidium bromide.

To identify the presence of the transgene, PCR assays are performed for each mouse. We have already outlined the assay,16 which is based on the assay described by Mangiarini et al. in 1996,9 and on a personal communication from P. Schweitzer (Jackson Laboratory). To prepare 10 ml of lOx reaction buffer, the components are as follows: 670 mM Tris-base, 166 mM NH4SO4, 20 mM MgCl2, bovine serum albumin (BSA, 1.7 mg/ml), and 10 mM 2-mercaptoethanol, all dissolved in 9 ml of Tris-EDTA (TE), pH 8.8. The final volume of lOx reaction buffer is brought up to 10 ml, and sterile filtered. For each PCR, 5 /xl of the buffer is mixed with 5 /xl of dimethyl sulfoxide (DMSO), 1 /xl (50-100 pmol) of each of the primers, and a 0.5 mM concentration of each dNTP (1 /xl of a 25 mM stock). We have also tested the results of adding more MgCl2 to the reaction mix—from 2.0 to 4 mM—and concluded that 2.0 mM is the optimal concentration. A 4-//1 sample of DNA previously obtained from a mouse is added to the reaction mix. One unit of Taq polymerase (diluted to 1 U/5 /xl of sterile water) is used, and a final volume of 50 /xl per reaction is obtained by the addition of sterile water. The use of appropriate controls, as in any PCR assay, is critical. For positive controls we utilize as DNA templates the pGemHDEL plasmid, which contains 4 kb of human genomic DNA including the first exon of the htt gene (a gift from A. J. Tobin and G. Lawless, University of California, Los Angeles, CA), and DNA from a patient (obtained from E. Alonso, Instituto Nacional de Neurología y Neurocirugía, Mexico City, Mexico). As negative controls, we routinely substitute DNA for water, and also use DNA from nontransgenic mice, preferably from another strain. Primer sequences are GCAGCAGCAGCAGCAACAGCCGCCACCGCC and CGGCT-GAGGCAGCAGCGGCTGT. Samples are overlaid with mineral oil and placed in a Stratagene (La Jolla, CA) RoboCycler 40. Samples are denatured at 94° for 90 sec, and then 35 cycles of the following protocol are run: 30 sec of denaturation (94°), 30 sec of annealing (65°), and 30 sec of extension {12°). A final extension step of 10 min is performed. Eighteen to 20 /xl of each sample is run on a 3% (w/v) agarose gel, and the PCR products are stained with ethidium bromide and observed with UV light (Fig. 1).

Behavioral Analyses and Phenotype

Four lines of transgenic mice carrying the huntingtin exon 1 with expanded CAG repeats were originally reported, and three of the lines, R6/1, R6/2, and R6/5, show a progressive neurological phenotype.9 However, R6/2 mice present

20 R. López-Revilla, L. Chávez-Dueñas, and Y. Azamar, Focus 21, 14 (1999).

0 0

Post a comment