Gapd

ActD

Propidium iodide

Fig. 1. Cell synchronization and Topo II mRNA stability assay. HeLa cells synchronized by mitotic shake-off were replated and pulse labeled with BrdU at representative times during the cell cycle. (A-D) Contour plots of cell cycle phase distribution assayed by FACS analysis at 1 hr (A), 12 hr (B), 16 hr (C), and 20 hr (D) after mitotic shake-off. Arrows represent cells in Gi, S, and G2 phases. (E) Northern blot analysis of Topo II mRNA in early Gi, and late S, and G2 phases. Synchronized HeLa cells either in G| phase (1 hr) or S phase (14 hr after plating) were treated with actinomycin D to block new transcription. Total cellular RNA was isolated from cells immediately after addition of the drug and after culture for 4 hr. The blots were rehybridized with human GAPD cDNA to quantitate the amount of RNA loaded per time point. The blots were exposed to a Phosphorlmager screen and the abundance of Topo II mRNA was determined relative to that present initially in the untreated cells.

the following intron (860 nt), and exon 2 (150 nt) is amplified by polymerase chain reaction (PCR) from human genomic DNA (Clontech), using primer pairs 5' _562GGGGCGGGGTTGAGGCAGATGCCAGAATCT_532 3' and 5' +150AGGT GTCTGGGCGGAGCAAAATATGTTCC+12i 3'.15 The samples are denatured initially at 94° for 2 min and amplification is performed with a DNA thermal cycler (GeneAmp PCR system 9600; PerkinElmer, Norwalk, CT) at 94° for 30 sec, annealing at 60° for 30 sec, and extension at 72° for 30 sec for 25 cycles. The final cycle is followed by a 10-min extension step at 72°. The PCR-amplified fragment is cloned into TA-cloning vector (Invitrogen, Carlsbad, CA) and inserted clones are selected on the basis of blue/white color. The Topo II promoter-containing insert in the TA plasmid DNA is excised with SpeI and Xhol restriction enzymes and directionally cloned into Smal- and X/?oI-digested pNASS/S plasmid DNA. The resulting reporter construct (H/jgalSV40), when expressed, transcribes a Topo II promoter-driven /3-galactosidase reporter mRNA with the simian virus 40 (SV40) 3' untranslated region (UTR) at its 3' end (approximately 3 kb in size). In the second reporter construct (H/ßgalTopo), the SV40 3' UTR in H/SgalSV40 plasmid DNA is removed by Sail and BamHl restriction enzyme digestion and replaced with the human Topo II3' UTR. The Topo II3' UTR is excised by Xhol and BamHl restriction enzyme digestion of plasmid DNA containing the entire human Topo II cDNA.16 The resulting reporter HßgalTopo construct, when expressed, represents an approximately 4-kb /S-galactosidase reporter mRNA with the Topo II 3' UTR at its 3' end.11 Orientation and sequence of all inserts are verified by dideoxy sequencing of both strands of DNA in each plasmid construct.

Mouse NIH 3T3 fibroblast cells are stably transfected with plasmid DNAs pSVneo (Clontech), HßgalTopo, or H/3galSV40, using LipofectAMINE according to the manufacturer-supplied protocol (GIBCO-BRL, Grand Island, NY). Geneticin-resistant colonies are pooled or individually cloned, and cultured in G418-containing medium. Asynchronously growing cells are synchronized by incubating monolayer cultures for 30 hr in medium containing 0.2% (v/v) serum and stimulated to reenter the cell cycle in medium containing 10% (v/v) serum. Cells are harvested at various times for analysis of cell cycle position and reporter mRNA levels. For analysis of cell cycle position, cells are harvested by trypsinization and fixed in 70% (v/v) ethanol. The cell pellet is digested with RNase A (1 mg/ml) and stained with PI (10 /xg/ml) for FACS analysis. Figure 2A shows representative histograms of cell cycle positions after reentry into the cell cycle. The majority of the cells are in G] phase (approximately 85%) at the time of serum stimulation (0 hr) and 6 hr after the stimulation. At 20 hr after serum stimulation 58% of the cells enter S phase and approximately 20-30% of the cells enter G2/M phase 24 hr

15 D. Hochhauser, C. A. Stanway, A. L. Harris, and I. D. Hickson, J. Biol. Chem. 267, 18961 (1992).

16 M. Tsai-Pllugfelder, L. F. Liu, A. A. Liu, K. M. Tewey, J. Whang-Peng, T. Knutsen, K. Huebner, C. M. Croce, and J. C. Wang, Proc. Natl. Acad. Sei. U.S.A. 85, 7177 (1988).

0 0

Post a comment