Pak

Spin down the DNA, wash with 70% ethanol, dry and dissolve in 20 pi of TE and use 2-5 jixl (-100 -300 ng) for PCR

FIG. 3. Flow chart representing reaction conditions for bisulfite treatment and amplification of the converted DNA.

precipitated with ammonium acetate (2.5 M, final concentration) and 3 volumes of ethanol with 1 fig of glycogen as carrier at —80° for 1 hr or at —20° overnight. The DNA pellet is washed with 75% (v/v) ethanol, dried, dissolved in 20 fi\ of TE, and stored at —20° in small aliquots. As a control for bisulfite reaction, the promoter region of interest (in this case mouse or rat MT-I promoter) cloned into a bacterial plasmid DNA can be used. Because CpGs are not methylated in bacteria, complete conversion of cytosines to uracils is expected. Therefore, the cloned promoter DNA isolated from bacteria will serve as a negative control. The same plasmid DNA methylated with CpG methylase (New England BioLabs, Beverly, MA) in vitro before bisulfite treatment can be used as a positive control.

Amplification ofMT-I Promoter from Bisulfite-Treated Genomic DNA by Nested Polymerase Chain Reaction with Gene-Specific Primers

An aliquot of the converted DNA 100 to 300 ng) is used for amplification of the MT-I promoter. We use nested PCR for amplification of the MT-I promoter from bisulfite-converted DNA. To amplify both methylated and unmethylated molecules we have designed primers from the regions of the promoter that do not harbor any CpG dinucleotides (see Fig. 4). Amplification of 200 to 500 bp is preferable, and it is difficult to amplify a region >550 bp as the size of chromosomal DNA after bisulfite treatment is considerably smaller. To amplify the upper strand of the bisulfite-converted mouse MT-I gene spanning the promoter region (Fig. 5) the following primers are used.4

For first round of PCR: mMTI-S 1: 5' -TAGAGTAGATGGGTTAAGGTGAGTG mMTI-Al : 5'-ATCCCCACTTAATATTCTAAAAACC For nested PCR: mMTI-S2: 5'-AGGAGTAGAGAATAATGTTGAGATGAGT mMTI-A2:5'-CTTAAAAAACAACCTACCCTCTTTATAAT

Similarly, —304 bp to +148 bp of the rat MT-I promoter is amplified with two sets of primers from bisulfite-treated DNA derived from the liver and hepatoma. The following sets of primers are used to amplify the upper strand of rat MT-I promoter from bisulfite-treated DNA.12

For first round of PCR: rMTI-T 1:5'-GAAAGGAGAAGTTGAGGATAGTGTGTTATG rMTI-T2:5'-TACCCCAAACCCCAACAAAAAACCATTC For nested PCR: Hepa-A2:5'-CCAAACCCCTACAACTAAATATTC Hepa-S2: 5'-GTATTGGATTAGTGATGGTTTGTAATAT

Restriction Enzyme Analysis of Polymerase Chain Reaction Product to Confirm Completion of Bisulfite Treatment and Presence of Methyl-CpG Dinucleotides

Next, the PCR product is separated by agarose gel electrophoresis and the amplified DNA (524 bp for the mouse MT-I promoter and 452 bp for the rat MT-I promoter) is extracted from the gel slice and purified, using Qiaquick gel extraction kit (Qiagen). To test the efficiency of the bisulfite reaction, the amplified DNA is digested at 37° for 2 hr with the restriction enzymes Apol (recognition site, G/C^AATTiA/T) and Tsp509\ (cleavage site, ^AATT-,), which can cut only

12 S. Majumder, K. Ghoshal, Z. Li, and S. T. Jacob, J. Biol. Chem. 274, 28584 (1999).

-526bp

|_Primer mMTl-S2__Tsp 5091

AGGAGTAGAGAATAATGTTGAGATGAGTTTTGTTGGCTAAAA'Î^ATTAAGGTTAGTTTTTATAA

Tsp 5091 Taq 1

^ATTGTTTTTTTTTTrrTTAGTT^GATTTAGAGAGAGATTTGGGCGGAGTTGGTCGTTGTTTAG

Tsp 5091/Apo I

(^.ATTTTAGGAAAGGAGAAGTTGAGGTTATTACGTTGCGAATGGGTTTACGGAGATAGTTGGT

Msp I lost Tsp 5091/Apo I

TTTTCGGGGTGAGTTGAGTTTTCGT^ATTTTAGAGTAGCGATAGGTCGTAATATCGGGGAAA

Taq X

gtattatagggatatgatgttttatacgttatatgggtrgttttattcgagttagtcgtgttaa

Taq 1

AGGCKjCGGTTTCGTTGTGTATATTGGCGTTTTAGGGAGTTTTGTATTTCGT^GAAAAGTGCG Msp I lost

TICfiGTTTTGTTAAGGACGCGGGGCGCGTGATTATGCGTGGGITGGAGTAATCGTTTGTTGGG

Tsp 5091/Apo I Msp I lost "2fp

TGTj^AITrTrTGCGITCi^ATTCGTTrAACG^TTATAAAGAGGGTAGGTTGTTrTTTAAG

TAATATTTCTCCCATCCAACAAAAAATTC Primer mMTl-A2

FlG. 4. Sequence of bisulfite-converted mouse MT-I promoter. The primers used for nested PCR of bisulfite-converted DNA and the restriction sites generated or lost are underlined.

the bisulfite-treated DNA (Fig. 4) but not the unconverted DNA (Fig. 5). The restriction sites for these two enzymes are generated only when cytosine residues are converted to thymine residues. The efficiency of bisulfite conversion is confirmed by a complete restriction cut of the amplified DNA (1 ¡ig) with Apol or Tsp5Q9\. Partial cleavage indicates incomplete bisulfite conversion. The present

0 0

Post a comment